گروه زیست شناسی

سازمان آموزش و پرورش استان آذربایجان غربی

فصل اول از ژن تا پروتئین

۱ – علت بیماری آلکاپتونوریا چیست و علامت این بیماری کدام است؟

۲ – در آزمایش بیدل و تیتوم، هاگ های جهش یافته، چند گروه بودند و هر کدام برای رشد در محیط حداقل به چه ترکیباتی نیازمند بودند؟

۳ – کپک نوروسپورا، چه نوع چرخه زندگی دارد؟

۴ – در آزمایشات بیدل و تیتوم، به محیط کشت جهش یافته های گروه دوم، چه موادی باید افزود تا هاگها رشد کنند؟

۵ – بیدل و تیتوم از آزمایشات خود چه نتایجی گرفتند؟

۶ – نظریه یک ژن – یک آنزیم بر اساس چه یافته هایی به نظریه یک ژن- یک رشته پلی پپتید تبدیل گردید؟

۷ – در رابطه ی :                         آنزیم۳             آنزیم۲                  آنزیم۱

( آرژینین              سیترولین               اُرنیتین              X ماده)

اگر آنزیم۱ غیر فعال شود، کدام ماده لازم است به محیط کشت اضافه شوند تا رشد هاگ کپک نوروسپورا انجام گیرد؟

۸ – در مسیر متابولیسمی، برای تولید اسید آمینه آرژینین در کپک نوروسپورا، چند مولکول mRNA و چند آنزیم تولید می شود؟

۹ – الف- از اطلاعات ژنتیک برای ساختن چه ترکیباتی استفاده می شود؟

ب- چرا رمزهای DNA باید۳ حرفی با شند؟

ج- در هر نوکلئوتید کدام ترکیب، علامت رمز محسوب می شود؟

۱۰ – بر اساس چه اطلاعات و شواهدی، دانشمندان یقین حاصل کردند که مولکول میانجی در پروتئین سازی باید مولکول RNA باشد؟

۱۱ – در سلول، چند نوع  RNA یافت می شود و نقش هر کدام چیست؟

۱۲ – اولین قدم جهت ساخت پروتئین، چه فرایندی است؟

۱۳ – در سلول های پروکاریوتی چند نوع RNA پلیمراز وجود دارد؟

۱۴ – در سلولهای یوکاریوتی چند نوع RNA پلیمراز وجود دارد و نقش هر کدام چیست؟

۱۵ – رونویسی از ژن های RNA های کوچک را کدام آنزیمها در یوکاریوتها انجام می دهند؟

۱۶ – راه انداز در چه مولکولی وجود دارد و نقش آن چیست؟

۱۷ – الف- مونومرهای جایگاه پایان رونویسی چه نام دارد؟

ب- در هنگام رونویسی از DNA چه مولکولی دو رشته DNA  را از هم جدا می کند؟

۱۸ – فرایندهای همانند سازی DNA و رونویسی DNA چه شباهتها و تفاوت هایی با یکدیگر دارند؟

۱۹ – چگونه می توان پیام t RNA را معلوم کرد؟

۲۰ – کدون را تعریف کنید و ویژگی عمومی آنها را بنویسید؟

۲۱ – فرایند ترجمه را تعریف کنید؟

۲۲ – آنتی کدون را تعریف کنید و نقش آن را در سنتز پروتئین بنویسید؟

۲۳ – علت تشکیل ساختار برگ شبدری در t RNA چیست؟

۲۴ – الف- ساختار ۳ بعدی t RNA در سلول چه نام دارد؟

ب- در ساختار برگ شبدری t RNA علت تشکیل حلقه ها چیست؟

ج- نقش حلقه های جانبی در t RNA چیست؟

د- با توجه به اینکهt RNA تک رشته ای است، علت بخش های دو رشته ای در ساختار آن چیست؟

۲۵ – در محل اتصال آمینواسید به t RNA چه نوع توالی مشاهده می شود؟

۲۶ – هر ریبوزوم چند جایگاه دارد و در هر جایگاه چه فرایندی روی می دهد؟

۲۷ – الف- اولین فرایند در مرحله ی آغاز ترجمه کدام است؟

ب- در مرحله ی آغاز ترجمه t RNA ی آغازگر به کدام جایگاه وارد می شود و آنتی کدون آن شامل چه نوع توالی است؟

ج- اگر یک رشته پلی پپتیدی درجایگاه A دارای۷ اسیدآمینه با شد ریبوزوم چند بار در طول m RNA حرکت کرده است و حداقل چند پیوند هیدروژنی شکسته شده است؟

۲۸ – در مرحله آغاز فرآیند ترجمه چگونه ساختار ریبوزوم برای ترجمه کامل می شود؟

۲۹ – الف- اولین آنتی کدونی که در جایگاه P ریبوزوم قرار می گیرد، چیست؟

ب- اگر رمز DNA ، TTC باشد آنتی کدون مربوط به آن چیست؟

۳۰ – مرحله ی ادامه ی ترجمه چگونه آغاز می شود؟

۳۱ – در کدام جایگاه ریبوزوم  پیوند پپتیدی تشکیل می شود و ضمن جا به جایی ریبوزوم  کدام جایگاه خالی می شود؟

۳۲ – الف- عامل پایان ترجمه به کدام جایگاه وارد می شود؟

ب- عامل پایان ترجمه چه نقشی به عهده دارد و این نقش را در کدام جایگاه به انجام می رساند؟

ج- چگونه فرآیند ترجمه پایان می پذیرد؟

۳۳ – در ارتباط با توالی نوکلئوتید روبه رو :

CGCAUCAUGCUCUUUAGCUAGCUG

الف- آنتی کدون t RNA آغازگر بر روی کدام کدون قرار می گیرد؟

ب- آخرین رمز قرار گیرنده در جایگاه P ریبوزوم کدام است؟

ج- سومین آمینواسید در زنجیره ی پلی پپتید مربوطه چه نام دارد؟

د-  آخرین آمینواسید متصل به آخرین t RNA در کدام کدون قرار می گیرد؟

۳۴ – با توجه به m RNA داده شده جهت ترجمه به سؤالهای زیر پاسخ دهید؟

AGU UAC AUG ACG CCA UUA UGU UAG GUA

الف- اگر ترجمه توسط ریبوزوم از محل درست آغاز گردد تعداد آمینواسید تشکیل شده در زنجیره ی پلی پپتید را مشخص کنید؟

ب- ریبوزوم حین ترجمه در طول m RNA ی فوق چند بار حرکت می کند؟

ج- جایگاه P و A هر کدام چند بار توسط t RNA اشغال شده است؟

۳۵ – ژن های گسسته در چه سلول هایی وجود دارد ؟ و چرا به این نام خوانده می شود؟

۳۶ – اگزون و اینترون را تعریف کنید؟

۳۷ – الف- مونومرهای توالی اگزون چه نام دارد؟

ب- علت کوتاه شدن m RNA در سلولهای یوکاریوتی چیست؟

ج- علت گسسته بودن ژنها در سلولهای یوکاریوتی کدام است؟

د-m RNA ی بالغ در چه بخشهایی از سلول تشکیل و در چه بخشی از سلول ترجمه می شود؟

۳۸ – یک m RNA که از چهار اگزون و سه اینترون تشکیل شده است، برای حذف اینترونها چند پیوند فسفو دی استر شکسته می شود و برای اتصال اگزونها چند پیوند فسفو دی استر تشکیل می شود؟

 

 

معصومه جبار زاده – خوی

ديدگاه ها غير فعال شده اند